On Fri, 17 Aug 2001 18:25:41 +0100, Scott Hill wrote:
>"Ron Parker" <ron### [at] povrayorg> wrote in message
>news:slr### [at] fwicom...
>> On Fri, 17 Aug 2001 16:41:31 +0100, Scott Hill wrote:
>> >    I only ask because with all the talk about 3.5 lately (particularly
>what
>> >will and won't be included) it would be nice to know whether what one is
>> >reading carries any kind of weight (that is, assuming the TAG team know
>what
>> >they're talking about regarding 3.5)...
>>
>> They do,
>
>    They do ? I didn't want to point fingers, but, lets see, shall we :

I meant "they do know what they're talking about regarding 3.5."

>    Sure, but there's a lot of talk about 3.5 around atm, and it would be
>nice to have some indication of what's likely to be true, without having to
>remember exactly who is a TAG member...

Well, those who post with "@tag.povray.org" on their addresses might be
TAG members.

My point is that as Chris mentioned in his post, there are people who have 
access to pre-beta builds of 3.5 who are neither Team members nor TAG
members, so knowing who is and isn't won't help a bit with your real 
concern.

-- 
#local R=<7084844682857967,0787982,826975826580>;#macro L(P)concat(#while(P)chr(
mod(P,100)),#local P=P/100;#end"")#end background{rgb 1}text{ttf L(R.x)L(R.y)0,0
translate<-.8,0,-1>}text{ttf L(R.x)L(R.z)0,0translate<-1.6,-.75,-1>}sphere{z/9e3
4/26/2001finish{reflection 1}}//ron.parker@povray.org My opinions, nobody else's

Post a reply to this message

"Ron Parker" <ron### [at] povrayorg> wrote in message
news:slr### [at] fwicom...
>
> Well, those who post with "@tag.povray.org" on their addresses might be
> TAG members.
>

    Sure, but my news reader just lists, for example, Warps posts as from
"Warp", I only get to see the @tag.povray.org if I specifically check the
message properties, or someone, with a reader that put's it into 'previous
message' bit, replies to one of his posts...

> My point is that as Chris mentioned in his post, there are people who have
> access to pre-beta builds of 3.5 who are neither Team members nor TAG
> members, so knowing who is and isn't won't help a bit with your real
> concern.
>

    And my point was that there are people saying things about 3.5 and in
the vast majority of cases there's no easy way to determine how valid what
is being said is - if one could just glance at the .sig and see 'TAG' then
one could assume that what they're saying is probably accurate - as it
stands, unless you know that someone is a TAG or POV-Team member or you go
to the effort of finding out, the only safe thing to do is to take any talk
of 3.5 with a pinch of salt...

BTW, yes, all this is dependant on what news reader one is using and a
better one would list the authors full e-mail address, but, just how many
people are reading these groups in anything other than OE (or another reader
that hides the information) ?
--
Scott Hill.
Software Engineer.
E-Mail        : sco### [at] innocentcom
Pandora's Box : http://www.pandora-software.com

*Everything in this message/post is purely IMHO and no-one-else's*

Post a reply to this message

Scott Hill <nos### [at] nospamthanks> wrote:
: (that is, assuming the TAG team know what
: they're talking about regarding 3.5)...

  I wouldn't bet on that...

  Just kidding ;)

  Could this be good?:

--
#macro N(D,I)#if(I<6)cylinder{M()#local D[I]=div(D[I],104);M().5,2pigment{
rgb M()}}N(D,(D[I]>99?I:I+1))#end#end#macro M()<mod(D[I],13)-6,mod(div(D[I
],13),8)-3,10>#end blob{N(array[6]{11117333955,
7382340,3358,3900569407,970,4254934330},0)}//      (TAG-member)   - Warp -

Post a reply to this message

Scott Hill <nos### [at] nospamthanks> wrote:
: people are reading these groups in anything other than OE (or another reader
: that hides the information) ?

  Is this the famous "information hiding" thing which most OO-programming
people talk about? ;)

  (I could make a Microsoft joke about that, but I'll reserve those to
povray.off-topic.)

-- 
#macro N(D,I)#if(I<6)cylinder{M()#local D[I]=div(D[I],104);M().5,2pigment{
rgb M()}}N(D,(D[I]>99?I:I+1))#end#end#macro M()<mod(D[I],13)-6,mod(div(D[I
],13),8)-3,10>#end blob{N(array[6]{11117333955,
7382340,3358,3900569407,970,4254934330},0)}//                     - Warp -

Post a reply to this message

"Warp" <war### [at] tagpovrayorg> wrote in message
news:3b7d6c1f@news.povray.org...
>
>   Could this be good?:
>
> --
> #macro N(D,I)#if(I<6)cylinder{M()#local D[I]=div(D[I],104);M().5,2pigment{
> rgb M()}}N(D,(D[I]>99?I:I+1))#end#end#macro M()<mod(D[I],13)-6,mod(div(D[I
> ],13),8)-3,10>#end blob{N(array[6]{11117333955,
> 7382340,3358,3900569407,970,4254934330},0)}//      (TAG-member)   - Warp -

    Yeah, that's the kinda thing I was thinking of - just some easy way to
see that what you write carries some weight and that you probably do know
what you're talking about...

--
Scott Hill.
Software Engineer.
E-Mail        : sco### [at] innocentcom
Pandora's Box : http://www.pandora-software.com

*Everything in this message/post is purely IMHO and no-one-else's*

Post a reply to this message

Scott Hill wrote:
> 
>     I know it's possible to find out at http://tag.povray.org/ but, would it
> be possible for all the tag members to put something in their respective
> .sigs to this effect ?


-- 
Ken Tyler - TAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAG
TAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAG
TAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAG
TAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGMember

Post a reply to this message

Scott Hill <nos### [at] nospamthanks> wrote:
:     Yeah, that's the kinda thing I was thinking of - just some easy way to
: see that what you write carries some weight and that you probably do know
: what you're talking about...

  Somehow I feel like it would be too much "advertising". Like saying
"Hey! Look everybody! I'm a TAG member and you aren't, he he!".

-- 
#macro N(D,I)#if(I<6)cylinder{M()#local D[I]=div(D[I],104);M().5,2pigment{
rgb M()}}N(D,(D[I]>99?I:I+1))#end#end#macro M()<mod(D[I],13)-6,mod(div(D[I
],13),8)-3,10>#end blob{N(array[6]{11117333955,
7382340,3358,3900569407,970,4254934330},0)}//                     - Warp -

Post a reply to this message

Ken <tyl### [at] pacbellnet> wrote:
: -- 
: Ken Tyler - TAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAG
: TAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAG
: TAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAG
: TAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGMember

  I think that's a bit too unnoticeable. It would be quite difficult for
people to see it.

-- 
#macro N(D,I)#if(I<6)cylinder{M()#local D[I]=div(D[I],104);M().5,2pigment{
rgb M()}}N(D,(D[I]>99?I:I+1))#end#end#macro M()<mod(D[I],13)-6,mod(div(D[I
],13),8)-3,10>#end blob{N(array[6]{11117333955,
7382340,3358,3900569407,970,4254934330},0)}//                     - Warp -

Post a reply to this message

> Ken Tyler - TAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAG
> TAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAG
> TAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAG
> TAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGMember

Well, apart from the member bit at the end, it's a remarkably monotonous 
DNA sequence, coding for 98 consecutive Leucine Amino acids, which makes 
no useful protein that I'm aware of :)

Bye for now,
     Jamie.
(followups set to p.o-t)

Post a reply to this message

"Warp" <war### [at] tagpovrayorg> wrote in message
news:3b7e3c49@news.povray.org...
> Scott Hill <nos### [at] nospamthanks> wrote:
> :     Yeah, that's the kinda thing I was thinking of - just some easy way
to
> : see that what you write carries some weight and that you probably do
know
> : what you're talking about...
>
>   Somehow I feel like it would be too much "advertising". Like saying
> "Hey! Look everybody! I'm a TAG member and you aren't, he he!".

    Hmm, yeah, though, would anyone actually think that ?

--
Scott Hill.
Software Engineer.
E-Mail        : sco### [at] innocentcom
Pandora's Box : http://www.pandora-software.com

*Everything in this message/post is purely IMHO and no-one-else's*

Post a reply to this message